![]() This provides strong evidence that the samples have a common source. If two DNA profiles from different samples are the same, the chance that the samples came from different people is low. A forensic scientist can use this information to determine if a body fluid sample comes from a particular person. The number of times a nucleotide sequence is repeated in each STR can be calculated from the size of the STRs. This is the same piece of equipment used in the lab for DNA sequencing. The genetic analyser separates the copied DNA by gel electrophoresis and can detect the fluorescent dye on each STR. The size of the STRs at each genetic locus is determined using a genetic analyser. Specific primers are used during PCR that attach a fluorescent tag to the copied STRs. Find out more in the article What is PCR? Often only small amounts of DNA are available for forensic analysis so the STRs at each genetic locus are copied many times using the polymerase chain reaction (PCR) to get enough DNA to make a profile. ![]() Chemicals are added to break open the cells, extract the DNA and isolate it from other cell components. Find out more in the articles Forensics and DNA and Crime scene evidence.ĭNA is contained within the nucleus of cells. DNA can also be collected directly from a person using a mouth swab (which collects inner cheek cells). Forensic scientists and Police officers collect samples of DNA from crime scenes. Traces of DNA can also be detected in body fluids, such as saliva and perspiration because they also contain epithelial cells. How do you create a DNA profile using STR?ĭNA is found in most cells of the body, including white blood cells, semen, hair roots and body tissue. These genetic loci are usually on different chromosomes.Ī DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a particular person. One way to produce a DNA profile, is for scientists to examine STRs at 10 or more genetic loci. STRs are found at different places or genetic loci in a person’s DNA. Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.įor example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times. One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats. identify disaster victims, for example, ESR scientists travelled to Thailand to help identify victims of the 2004 Boxing Day tsunami.identify the probable origin of a body fluid sample associated with a crime or crime scene.Human DNA profiles can be used to identify the origin of a DNA sample at a crime scene or test for parentage. DNA polymorphisms can be analysed to give a DNA profile. Each of us inherits a unique combination of polymorphisms from our parents. Differences in these variable regions between people are known as polymorphisms. No sequence variation was detected in 40 kb of DNA flanking two 70 kd hsp genes which are not stimulated by heat shock. elegans in regions flanking three members of the 70 kilodalton (kd) heat shock peptide (hsp) gene family. However, specific regions vary highly between people. 19 Citations Metrics Summary We have searched for sequence variation between the Bristol and Bergerac strains of C. These ionic gradients across the resting membrane are maintained by the active transport of lons by the sodium-potassium pump which transports 3 Na +outwards for 2 K into the cell.DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissueĮven though we are all unique, most of our DNA is actually identical to other people’s DNA. a high concentration of Na +and thus form a concentration gradient. In contrast, the fluid outside the axon contains a low concentration of K. the axoplasm inside the axon contains high concentration of K +and negatively charged proteins and low concentration of Na +. the membrane is impermeable to negatively charged proteins present in the axoplasm. resting, the axonal membrane is comparatively more permeable to potassium ions ( K ∗ ) and nearly impermeable to sodium ions ( Na ∗ ). ![]() When a neuron is not conducting any impulse, i.e. These ion channels are selectively permeable to different ions. Do you know why the membrane of a neuron is polarised? Different types of ion channels are present on the neural membrane. ![]() Neurons are excitable cells because their membranes are in a polarised state. Views: 5,474 21.3.1 Generation and Conduction of Nerve Impulse ![]()
0 Comments
Ground thyme fresh1/3/2024 ![]() ![]() When adding dried herbs to a stovetop meal, it's best to add them to the recipe during cooking. In stovetop recipes, dried herbs generally work the same, or better than fresh herbs. ![]() This means that even if fresh herbs are used, they will have the same impact as dried ones. While you can use fresh herbs, after cooking them for 10 minutes or longer, the natural oils that make the herbs taste fresh are released. The rule of thumb is that if you are cooking a dish on the stovetop for more than a few minutes, it's best to use dried herbs. Dried herbs that have been sitting on a shelf for longer than a year tend to lose their flavor and not be as potent. If you purchase dried herbs that are lacking in flavor, it may be worth checking when they were packaged. ![]() Herbs that have been recently dried usually have a stronger flavor, which means that you can use less of them to achieve the same result. Simply put, dried herbs are herbs that have been intentionally dried to help preserve their flavor and create a shelf-stable herb that will last for a longer time. Keep scrolling to discover more about these flavorful ingredients! Dried Herbs What Are Dried Herbs? To help you better understand the differences between both and when to use each, we've created this guide that compares dried vs. While there's nothing quite like fresh herbs, there are several recipes in which dried herbs can lend their own unique flavor. And if you do purchase them fresh, you must store them properly so that they don't spoil quickly. Unless you have a garden that you're growing fresh herbs in, buying them at the grocery store can be inconvenient. If you're trying to incorporate wholesome foods into your diet, your first thought might be "the fresher, the better." While this is an excellent rule to follow with many foods, when it comes to herbs, depending on the recipe, fresh herbs may not always be the best choice when cooking at home. ![]() Rainmeter reddit1/3/2024 ![]() ![]() An element of a culture… lotti osama About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features NFL Sunday Ticket Press Copyright. Memes! A way of describing cultural information being shared. Gregg was largely the one who started the emasculated stereotype of lightskin men through many Vines that have since been scrubbed from the internet.32 votes, 11 comments. Lightskin-based memes started on Vine in 2013, predominantly perpetuated by Viner Melvin Gregg and Viner King Bach. About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features NFL Sunday Ticket Press Copyright. Its association with the notion of having "rizz," or even "unspoken rizz," means that sometimes, social media users are having to decode multiple memes. Tempur Choice Supreme Urs Buhler Wife Gay Brothel Las VegasThe popularity of the "lightskin stare" meme is such that compilations have started appearing on YouTube, so it's worth hashing out the meaning and origins of the phrase. accident in 405 Rebuild World Chapter 32 Integrated Financial Management Information System In Uganda Everyday It S Getting Closer Tiktok Lumber Liquidators Danbury Ct Pvz2 Tier List 2022 U Richmond Supplemental Essays Promold One Touch Ohuhu Markers Art Mexican Shoulder Tattoos Lexus Ls 500 Used Muskogee Hair Salons Dentist On Atascocita Road. Lightskin Dog is a dog with relatively light skin, piercing eyes and, you might say, a “lightskin stare,” meaning it’s firmly part of the meme tradition.They have an affinity for bugging their parents, just as human children do. Bred as a sled dog, the Husky is known for his amazing endurance.Lightskin dog meme 20 votes, 16 comments. ![]() At that moment synonym1/3/2024 ![]() ![]() ![]() ID: GO:0042310 Synonyms: negative regulation of blood vessel size Articles referencing this term Fluorine in medicinal chemistryNeed synonyms for goes on to? Here's a list of similar words from our thesaurus that you can use instead. antonyms.Definition: A decrease in the diameter of blood vessels, especially arteries, usually causing an increase in blood pressure. Friday, 31st March 2023 152 other terms for go on forever - words and phrases with similar meaning. It just wasn’t a fair fight from the get go i let her finish all her buff’s just to.18K views, 1.7K likes, 632 loves, 7.9K comments, 1K shares, Facebook Watch Videos from Dag Heward-Mills: The FLOW Church with Evangelist Dag Heward-Mills. Kiriko from another world let’s say bc dude doesn’t utter a word outside of combat lol, GGO BOB Tournament! I know premiere is an Ai but still i feel like i did her dirty. how much does stevens transport pay Go to swordartonline r/swordartonline The answer today is a "busy" word, describing the act of moving not just quickly but in a rush, trying to clear tasks or get around as fast as possible, and. Synonyms and related words To behave in an uncontrolled way go to extremes rampage run amok. go one step further: Most historians use archives but Professor Bramanti has gone one step further by creating his own. suggest new.synonyms for goes on Compare Synonyms conduct endure go ahead happen hold on last occur persist proceed stay take place act advance bear behave carry on come about …1 to say or do something more extreme By sending Lister to prison, the judge went further than the law normally allows. "Now, turn around and look at me.".25malx vetco rabies clinic synonyms for going from Compare Synonyms about appertaining to appropriate to as concerns as regards attributed to away from based on belonging to characterized by coming from concerning connected with consisting of containing epithetical in reference to in regard to like made from out from out of peculiar to pertaining to proceeding from28 other terms for goes on forever - words and phrases with similar meaning. They fit him perfectly as if he had gone to buy them himself. ![]() "I am sure that these would also fit your feet.". Next, she brought out a pair of black high heels. Another word for goes on Another way to say As Time Goes On? Synonyms for As Time Goes On (other words and phrases for As Time Goes On).synonyms for forever Compare Synonyms always endlessly eternally permanently evermore perpetually durably enduringly everything considered for always for ever and ever for good for keeps for life forevermore immortally in perpetuity in perpetuum infinitely interminably lastingly now and forever on and on till Doomsday till blue in the faceIt was a G-string. ![]() Unfinished baby blocks1/3/2024 ![]() I've been writing down inscriptions as I come across them. Some have just the name and date like the today's blocks. Many of the blocks have sentiments inked on them for the Sarah and Maxon. Were Sarah and Maxom married? Perhaps, but as we continue on with the blocks you may begin to wonder about their relationship too. So many questions! There were members of the both Randolph and Dunham families in Illinois, Wisconsin and New Jersey. More leaves and flowers from the same print.ĭid anything jump out at you when looking at these first four blocks? The three donut blocks were all made in Illinois (the Midwest) and the red and green floral block was made on the east coast of the United States in New Jersey. You might not think it possible but you'll see it fussy cut later in the quilt. This donut block has a sweet spray of flowers in the corners and a cluster of leaves on the four sides. Before you decide, take a look at the cute broderie perse as we explore the first four blocks. At first I wasn't sure I liked them so I drafted a group of blocks from antique quilts that could be used as substitutes. I looked around and realized how many there actually were. Three of the first four blocks are donuts! When I drafted the first three blocks I got a little surprise? There are circles or donuts as I'm calling them, all over the quilt. Because this quilt has a pieced sashing I thought you might like to work on that as we go along so you could assemble your blocks. I've always jumped all over the place and given a layout to put the blocks together at the end. ![]() I've never done a block of the month where I presented the blocks in order. This picture is of the upper left corner. ![]() Oh my, the quilt looks so sad laying on the floor in the living room. I think hanging from the quilt stand in the garage might give the photographer enough room to capture the whole quilt in one shot. I'm still working on getting us a full view picture of the entire quilt. I believe the quilt was made for Sarah and Maxon Dunham by family and friends. If you haven't read the introduction post for this quilt you might want to take a few minutes to do that. This is a long post with lots of pictures and information. I have so much to tell you I'm not sure where to start. I am absolutely blown away by your enthusiasm for this project and hope you'll have a wonderful time as we work together on the blocks. I didn't know what was happening but I just entered and drove home.I have to start by thanking everyone for their patience while I got all the pieces and parts of the Dear Daughter block of the month organized. The only thing was that there was no one in the car! As the car reached me, the doors opened inviting me to enter. All of a sudden I noticed my car turning around and driving towards me. I walked up to my car which I could see in a distance but the woman was nowhere in sight. Then I slowly got out and started walking back in apprehension. I waited there for 5 minutes until there was no sign of the dog. ![]() Few blocks away I found a thick bush where I hid. In fear for my life I took off as her dog pounced towards me to attack me. From behind her came a nasty looking dog who was showing his huge teeth at me. As I walked towards her, I heard a sharp growl. So I went over to approach her if she could help me out in fixing my car. I couldn't see her face as it all seemed dark. I got out of the car to see what was wrong with my engine when I spotted a female figure in the distance. ![]() I was now in the middle of an unknown location. The music stopped and within a few minutes my car engine stopped too. While I was normally cruising down a block playing my favourite music, the radio suddenly began to cause static. For the past few days I had been working overtime which was the cause of me returning late. It was late at night that I was returning home from work. ![]() Which artisan mousepad to buy1/3/2024 ![]() ![]() Better control and stability can significantly improve your gaming ability. In my opinion, if you’re a beginner, go for the XSoft hardness. However, reviews suggest that this thickness didn’t really help beginners achieve that. These were launched in an attempt to offer players a middle ground between speed and stability. Soft thickness is the middle point of the hardnesses artisan mousepads come in. See also How To Order An Artisan Mousepad Through Their Website (With Pictures) This helps players get more speed on the mouse but at the cost of less control. Softer thickness means there is a lighter cushion for your wrist which compromises stopping power and stability, however, it allows more freedom when swiping the mouse across the mousepad. Mid is the softest thickness in artisan mousepads. This means, if you want better stability and the games you play require crucial stops to be made under a fraction of a second, XSoft would be the thickness for you. This hardness allows for a rigid cushion for your wrist when holding your mouse, ultimately allowing better stopping power. XSoft is the hardest thickness in artisan mousepads. I’ll try to give you a general idea of what difference there is between Artisan mousepad thicknesses. Now, for a beginner, it may be hard for you to decide which thickness is preferable for you. Here are their measurements: XSoft 4 mm Soft 3.5 mm Mid 3 mm Which Thickness/Hardness Is The Best In Artisan Mousepads?Īs shown above, Artisan mousepads offer 3 different thicknesses to choose from. What Thicknesses Do Artisan Mousepads Come In?Īrtisan mousepads come in 3 different thicknesses: Extra Soft, Soft, and Mid. If that’s a reason for you, go for Large.Įlse, XL would be the best. XL can be a bit too much for players and some find it harder to manage space for an XL mousepad with their keyboard on the same desk. This is because when gaming, you need a big free space for your mouse to travel around. It is a universal belief in gamers that the bigger the mousepad is, the better. Here are their measurements: S 24×21 cm M 31×24 cm L 42×33 cm XL 49×42 cm Which Size Artisan Mousepad Should I Buy? Let’s go through each decision one by one to help you choose the right artisan mousepad for extreme gaming! What Sizes Do Artisan Mousepads Come In?Īrtisan Mousepads come in 4 sizes: Small, Medium, Large, and Extra Large. With that, artisan does offer you to print a logo of your choice on the mousepad for free. Artisan mousepads really always go for minimalism in aesthetics. However, what they all share in looks is a simple and subtle design. The product, the size, and the thickness.Īrtisan mousepads offer different colour options for each mousepad as well. To clear things up for you, Artisan gives you three decisions to make. Now comes the time when you will have to browse and select the perfect artisan mousepad designed for you. Once you do enter a store to buy an artisan mousepad, you will face a wide variety of mousepads they offer. Both will have a good variety of Artisan Mousepads. If that doesn’t fulfil your needs, go for Amazon. In summary, try the Artisan website first. See also 17 Best VR Games To Play During Halloween It features a large variety of Artisan mousepad retailers and good return policies that can help you gain trust over it and choose it over the official Artisan store. These are the two reasons why you may find it helpful in some cases to buy artisan mousepads from Amazon instead.Īmazon is a trusted retail store and most people in the US are comfortable using it. There may be times that your preferred mousepad is out of stock on their website. ![]() I tried to use a Google Translate extension hoping it could help me but the page was too broken to process it. Plus, much of the content there is in Japanese, as it is a Japanese brand. I had to switch to Internet Explorer just to get the website to work. Like on Chrome browsers, for some reason the website’s elements don’t load properly. ![]() There are two reasons why Amazon may be a better option for you.įirstly, Artisan’s website is Japanese… and kinda broken. Here, you can find all the variety of products that they offer and accurate descriptions of the products. There are two stores I can recommend for buying Artisan mousepads: Artisan’s own website and Amazon.Īrtisan’s own website is the most recommended option. Bottom Line: Where Can I Buy An Artisan Mousepad From?.FX Artisan Mousepad Series: Which Is Better? Which Thickness/Hardness Is The Best In Artisan Mousepads?.What Thicknesses Do Artisan Mousepads Come In?.Which Size Artisan Mousepad Should I Buy?.What Sizes Do Artisan Mousepads Come In?.Where Can I Buy An Artisan Mousepad From?.How To Buy An Artisan Mousepad – Complete 2022 Guide Table of Contents ![]() Half off dominos online1/3/2024 ![]() ![]() There is no other brand that comes to mind when you say Pizza, except Domino's. They pride themselves in using freshly cut vegetables, and high-quality ingredients in making delicious pizzas, fillings, sandwiches, toppings and so much more! Check super deals and special discount coupon codes such as Dominos Wednesday offers, Freaky Friday Offers, Weekend Offers, and more. It forayed into the Indian market in 1996, and today it has more than 54% market share and 70% share in the home delivery segment of pizzas. ![]() It has the 2nd largest franchise chain in the US and worldwide with over 10,000 franchised and corporate stores. About Domino’sĭomino's Pizza, founded in 1960, headquartered in Michigan, United States is one of the market leaders in the pizza delivery industry. So, watch this page for the latest and exclusive offers available on pizzas. Most of these deals work for both new and old users. With just a few clicks, you get to save big on your pizza craving when you order pizzas. You can get discounts on your order through valid promo codes and exclusive deals available on GrabOn on all your orders at Domino’s. ![]() Get your Pizza delivered instantly by ordering online from Domino’s, the world’s favorite pizza platform. No matter what you order, we have a coupon to help you save on your orders. And while you are at it, don't forget to get exclusive coupons and discounts from GrabOn. Share the best pizzas in town with your friends and make everlasting memories while you eat. Up to 40% OFF On All Pizzas Domino's Vouchers And Offers With GrabOn Latest Dominos Coupon Codes, Promo Code & Pizza Offers for Today | 08 July 2023 Dominos Coupon Category ![]() Book ends diy1/3/2024 ![]() ![]() just wrap your each bookend (focusing on the front vs the sides) and tape underneath. to give the bookends a cleaner texture, cover the wedge with cardstock (which i unfortunately forgot to take a pic of). tape up the last end once it’s filled.ġ0. you can fill with sandwich bags full of sand (HA), rocks, dirt, dead batteries - anything that’s heavy. you can then turn it over and trim any excess. you’ll now you have pieces that should “plug in” to your existing wedge. cut that outside edge, but just the top layer and the corrugation. ![]() now do what you did before with the folds. it’s better to go outside the line here than inside the line (because you can always cut more off)Ġ8. cut out your triangles on the outer line. mark each triangle to its corresponding side.Ġ7. hold in place and mark both the inside and the outside with a pencil. use the wedge as a stencil on another piece of cardboard. From cute animal shaped homemade bookends made out of papier mache to modern pieces made from concrete or metal pipes there is sure to be diy bookend idea. mark each side of your wedge with a number or a symbol or a nickname or something, so you know which side is which later (when you’re cutting triangles)Ġ6. use the lip you cut out of the bottom to line-up a flush edge. ![]() fold together and tape to make your wedge. and then again at the tip (bottom) of the main piece.Ġ4. repeat this with the other mark on your main piece. DON’T CUT ALL THE WAY THROUGH. just cut through top layer, and through the corrugation of the cardboard (the wavy middle piece).Ġ3. once you’ve made two cuts on either side of the mark, you can use tweezers or your fingers to peel away the top layer along with the corrugation, leaving just the bottom layer and a blank space that lets you fold the cardboard in on itself. OUR SIZE FOR THE MAIN PIECE : 5” x 15 1/4” (4” base, 6 1/4” back, 5” diagonal)Ġ2. cut your main piece, and then mark lines at the 4” and 10 1/4” mark (see? 5” left? get it?) x-acto cut about 1/16th inch on either side of these marks. then unfold it to measure the pieces. we decided to make the sides (triangles) separately, so they would fit snug and custom to each end. if you want to make a mockup, build one at an approximate size to see the wedge shape. ![]() Funko pop pins star wars1/2/2024 ![]() ![]() ![]() Orders will ship only after all items are received at our warehouse. For faster delivery, order in-stock and pre-orders separately. However, all Star Wars figures in the line are bobbleheads, most Marvel figures. An update will be given if your order has been affected.Īll Pre-order and non-Funko in-stock item ship dates are subject to change. Most Funko Pop figures are not bobbleheads, as their heads do not move. He might play with your flashlight and steal your food, but hes still a great Jedi. If a Pre-Order item is damaged upon arrival, we will not ship your item until a replacement is received (item or box). This Funko Star Wars: Yoda POP Pin is blessing you with the force. This can be cancelled within 24 hours after purchase.Īll Pre-Order items have a mint guarantee (10 Grade). Pídelo antes de las 11h y recíbelo en 24-48h. POP Pins Star Wars - Jabba (Chase) cantidad. Tiendas Wefreak Envíos y devoluciones Contacto. A non-mint item may have a perfect grade but not defined as such by us. Tienda especializada en FUNKO POP Envíos en 24-48h laborables desde 2,99 GRATIS en pedidos superiores a 50. Mint items are strictly Pre-Order items direct from suppliers. ![]() Any Funko Pop Items larger than 6 Inch (10 Inch & 18 Inch) must. This Star Wars Pop Pin 4-Pack Set is just what you need to add a little flair to your. All 4 Inch Funko Pops will ship in soft protectors unless otherwise noted (sales, discounts). Mint Condition Guaranteed.FREE SHIPPING on eligible purchases. Chewbacca Riding in the AT-ST Imperial Walker is the chase piece of the series with a rarity of 1:12. Funko Pop Pins: Asst: Star Wars - Princess Leia, Darth Vader, Greedo, Han Solo LG Enml Pin with Chance of Greedo chase (Coming Soon). Buy Star Wars Funko Pop at Entertainment Earth. This is non-refundable and cannot be cancelled after purchase.Īll In-Stock items are non-mint (8 to 9 Grade). The 'Star Wars Pop Blind Box Pins' series is a collection of six Star Wars-themed pins produced by Loungefly and Funko. If other items are purchased with larger Funko items, one or more of the differing items will be automatically removed (in order to properly preserve your shipment). By purchasing this item, you agree to our Terms of Services.Īll 4 Inch Funko Pops will ship in soft protectors unless otherwise noted (sales, discounts).Īny Funko Pop! Items larger than 6 Inch (10 Inch & 18 Inch) must be purchased alone (Quantity of 1) with no other item in order to ship properly. ![]() Aa reflections today1/2/2024 ![]() ![]() My life is unfolding exactly as it should. At this moment my every need is being attended to. We will always get what we need, when we need it. We need not lament what we think we need. Celebrating what we get and knowing there is good in it eases whatever trial we are undergoing. We get what we need, in the way of relationships, adventures, joys and sorrows, today and every day. The experiences we are offered will fail to satisfy our expectations because we expect so much less than God has planned for us in the days ahead. Less so today than yesterday, but limited still. We simply don’t know just what’s best for us. Each time we choose to lament what isn’t, we close the door on the invitation to a better existence. However, in each circumstance we are offered an opportunity for growth or change, a chance for greater understanding of life’s heights and pitfalls. The circumstances of our lives seldom live up to our expectations or desires. I will take time to list all the ways I am now free. Guide me, for keeping my freedom is a big taskĪction for the Day: I will meditate on my freedom. Prayer for the Day: Higher Power, You set me free. Each day without alcohol or other drugs is a gift, a gift from God. So each day we keep learning, we keep growing. We also want to be happy, and to do something with our lives. We need to learn how to give and receive.įreedom from dependence is not enough. We need to learn new values and how to stand up for them. We need to let a Higher Power guide our hearts, and bodies. We need to let a Higher Power guide our hearts, minds, and bodies. But to keep this life, we need to change. We’ve been given a second chance or third chance.įor that, we thank our Higher Power. I’ll also remember that my need for help in maintaining sobriety will never end. I’ll be thankful today for the sobriety AA has given me. If AA was able to help us in our hour of desperate need, it can help us as the days unfold into the future. If we have found sobriety in AA, we have no need to look further. No program is useful to us if we cannot apply it in our own lives. The only real test for any program is that it works. The need is so great that we should welcome anything that helps alcoholics. We should, in fact, be delighted if ways are found to reach those whom we are unable to help. ![]() Nobody in AA should feel threatened by these new programs. These are designed to appeal to those who either will not or cannot accept AA. Now that alcoholism recovery has been well established, alternatives to the AA program are being developed. and have taught me many a valuable lesson.” But the reasonable ones have always done a great job for all of A.A. The unreasonable ones have taught me, I hope, a little patience. Both have often restrained me from doing much worse than I actually have done. “For myself, I have come to set a high value on the people who have criticized me, whether they have seemed reasonable critics or unreasonable ones. “Thanks much for your letter of criticism: I’m certain that had it not been for its strong critics, A.A. I pray that I may be content with doing small things as long as they are right. I pray that today I may do the next thing, the unselfish thing, the loving thing. Offering this day’s service to God, you are sharing in His work. In that spirit, a blessing will attend all that you do. Take each day’s happenings as opportunities for something you can do for God. Am I making progress?Įach new day brings an opportunity to do some little thing that will help to make a better world, that will bring God’s kingdom a little nearer to being realized on earth. has ever “arrived.” But we are getting better. And we will be on the way as long as we live. We are not so interested in what we are as in what we are becoming. we are willing to make mistakes and to stumble, provided we are always stumbling forward. We realize that perfectionism is only a result of false pride and an excuse to save our faces. we are content if we are making progress. Instead of being pretended perfectionists, in A.A. ![]() Thus, I receive support from many sources in staying away from the first drink. My sobriety is greatly enriched, and my practice of the Eleventh Step more fruitful, when I use both the literature and practices of my Judeo-Christian tradition, and the resources of other religions. If I keep an open mind about what others have to say, I have much to gain. There are others who are also engaged in a spiritual search. I do not claim to have all the answers in spiritual matters, any more than I claim to have all the answers about alcoholism. Be quick to see where religious people are right. ![]() AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |